tijdens de examens doe ik.....

Posts: 169

examens zucht, wat doe je zoal tijdens examens om je te ontspannen.
hm ik ben begonnen met het forum eens te lezen.
en kwou eigenlijk wel keer zien wat dat ier allemaal is
greetz stoop

2008-06-04 23:57:14
Posts: 231

Tijdens examens controleer ik twintig keer per dag het forum om te verifiëren dat er inderdaad nog altijd niets is bijgekomen...

2008-06-05 00:35:32
Posts: 169

hmmm zozo putte ook nog wakker zo zie je de echte werkers mijn vorige ontspanning was een jupke

2008-06-05 00:39:06
Posts: 329

Dacht dade gingt beginnen leren achter ons cske?

Uiteraard Welkom !!


2008-06-05 09:12:34
Posts: 169

tgaat em wel over pauze invulling é da bericht posten was 2 minuten werk dus da zit niet binnen pauze invulling (meer dan een kwartier) cs zit daar natuurlijk wel bij

2008-06-05 09:52:13
Posts: 231

Als alternatieve ontspanning kan je alle foto's nekeer bekijken en een lijstje maken van welke er 90 graden gedraaid zouden moeten worden

2008-06-05 15:27:38
Posts: 169

hmm nja ge moet wel zien het moet bevorderlijk blijven voor het gemoed eh ; eersgistern heb ik aan duckhunten gedaan, kan ook wel tellen en voor zei die het zich afvragen STATISTIEK IS TOF
greetz stoopke

2008-06-05 15:39:21
Posts: 329

daarom dak 2e zit eb voor statistiek, kwil et nog ne keer doen omdat zo tof is

2008-06-05 15:41:31
Bert Waelkens
Posts: 43

Nog 1241 uren en 5 minuten en we zijn op kamp!!!!

2008-06-05 15:56:11
Posts: 231

Tijdens examens doe ik een poging om op een zo onmenselijk mogelijk uur nog op het forum te zitten posten.

2008-06-10 01:35:36
Posts: 169

ik kijk elke avond naart laatste half uur van de laatste match van het EK dat maakt blij hehe met een pilsje

2008-06-10 20:38:46
Claas Van Assche
Posts: 238

tijdens de examens schiet ik bots 16 bots neer die enkel maar een mes hebben om zich te verdedigen. tsja, tis heerlijk om met een machine geweer op nen nest bots te schieten

2008-06-11 18:05:20
Claas Van Assche
Posts: 238

aja sorry en als ontspanning leer ik soms eens

2008-06-11 18:05:53
Posts: 329

Not funny cuz it's true !!

2008-06-11 20:22:35
Posts: 169

vandaag moest de film beerfest eraan geloven: niveau nul verstand op nul en lachen met vijf gasten die constant bier zuipen zou nen ideale film zijn voor gewestfilm hehe
voor de mensen die leren als ontspanning ... geen commentaar

gaan zou ik zeggen

2008-06-11 22:21:15
Posts: 169

tijdens de examens ben ik ook mijn status aan het verbeteren ik ben nu al een klj wasda trots trots

2008-06-11 22:25:51
Posts: 329

hehe beerfest, dien ebbek ook nog staan ma keb der nog alsan ni naar gekeken

Kvraag my wel af hoevel posts dak van de volgende status ben, want ik voel concurrentie :-O

2008-06-11 22:29:10
Posts: 231

Hopelijk nog ver, dan kan ik misschien toch tijdelijk even dezelfde status claimen als gij
Nee serieus, ik zou weer eens in de code moeten gaan zien, maar volgens mij zit ge er niet ver meer van. Spannend hé.

2008-06-11 23:27:19
Bert Waelkens
Posts: 43

Dat duckhunten was dat dan zo let wel: niet voor gevoelige kijkers.

2008-06-12 10:01:36
Bert Waelkens
Posts: 43

nog zo een dom filmpke, maar nu voor de derde leeftijd.

2008-06-12 10:15:56
Claas Van Assche
Posts: 238

lol, da laatste is wel de max

pff da duckhunten vinnek een beetje overdreven. En ze kunn ze nog ni eens in 2 schotn pasn, wel proficiat aan dien da 2 ducks in 1 shot a

2008-06-12 10:41:38
Posts: 169

nee bji ons is het duckhunten geplaatst in een meer primitieve sfeer: je neemt een hooivork (meest aangeraden door de lange steel) een zak en een vriend met ook een hooivork. ge zoekt nen nest ducks die nog net niet kunnen vliegen (anders oneerlijke strijd) en je probeert er zoveel mogelijk te snappen al dan niet levend in fase twee neem je toch het loodjesgeweer erbij

2008-06-12 13:57:28
Posts: 169

tijdens de laatste dagen van de exmanes doe ik: vooral verlangen naar het einde
plannen maken om mij regelrecht in de gracht te drinken
en pizza's eten

2008-06-22 18:40:19
Posts: 231

Tijdens de laatste dagen van de examens stel ik vast dat er al velen gedaan hebben en dat het forum weer een half jaar in onbruik zal geraken :-|

Snif snif...

Als we maar gezond zijn! En idd pizza's mogen eten.

2008-06-23 13:56:41
Posts: 169

aangezien ik de enigen duts ben die nog examens heeft nog twee bah, zal ik maar nog wat doorposten alhoewel er idd geen kloten van mensen nog reageerd. nuja die zuiplappen hebben wrschijnlijk wel iets beters te doen dan forum lezen ...

om bij het toppic te blijven tijdens de examens doe ik: veel te veel golden powerkes drinken van den aldi

2008-06-24 01:19:01
Posts: 329

Een half jaar putte?

U vergeet de herexamens

En op et tijdstip van u post stoop addek inderdaad wel iets beters te doen

2008-06-24 13:11:59
Posts: 231

[quote=stoopke]aangezien ik de enigen duts ben die nog examens heeft nog twee bah,...[/quote]

You insensitive clod! Ik buig mij binnen een goeie drie uur boven m'n examen IT security audit en overmorgen op hetzelfde uur over dat van change management.

Dus ge zijt nog altijd niet alleen

Nu rap voortdoen, 'k ben nog niet bepaald klaar met de voorbereidingen :-|

2008-06-24 15:10:13
Posts: 169

laten we dan elkaar steunen putte!!
ik heb donderdag ook mijn laatste. Misschien kan je vrijdag naar de klj komen kunnen we ons samen bezatten om het einde te vieren.

veel succes nog
enkel de echte hard werkende studenten hebben nu nog examens !!

2008-06-24 19:03:25
Posts: 231

Bon, terug thuis, en zo zit ik in de helft van mijn examenperiode

Idd, zo zie je tenminste eens wie de doorzetters zijn in deze maatschappij, en wie dan weer niet uit hetzelfde hout gesneden is en al voor 26 juni zijn toevlucht moet zoeken tot alcohol en andere decadente toestanden... Waar moet dat heen?

Ook veel sterkte, nog een klein "effortke" en euhm, dan kan ik weer gewoon gaan werken.

2008-06-24 22:13:49
Posts: 169

idd, onverantwoord al dat barbaars gedrag
men is de grondwaarde van het bestaan vergeten, zijn er nog waarden in deze maatschappij of wordt alles geridiculiseerd tot tot smadelijke practijken?

hm na 26 juni wat zal ik dan doen mm weekje vakantie en dan ....
opnieuw beginnen studeren pff
ook sterkte

2008-06-25 01:17:28
Posts: 169

een van mijn laatste tijdens de examen doe ik postst: examen vragen gewoon zielig vanbuiten leren in de hoop dat hij dezelfde vraagt
dat behoort tot mijn plan Z

sterkte putte

2008-06-25 19:39:48
Posts: 231

Tijdens de examens verdoe ik mijn tijd op Wikipedia en leer ik allerhande interessante stuff die ik altijd al had willen weten, zoals wat een lobotomie is (nl je frontale hersenkwabben tot puree roeren met een ijspiek) en dat deze barbaarse praktijk gedurende de jaren '40 en '50 heel vaak werd toegepast in de medische wereld om psychische stoornissen en onaangepast gedrag te behandelen (toen waren er nog geen middelen tegen depressie of epilepsie e.d. dus je moet het wel in z'n context zien). De "ice pick lobotomy" werd dusdanig alledaags dat mensen zelfs een lobotomie lieten uitvoeren op hun ongehoorzame kinderen Zelfs een 4-jarige. Ongelooflijk. De vader van John F. Kennedy liet het zelfs uitvoeren op z'n 23-jarige dochter, Rosemary Kennedy, waarschijnlijk omdat ze de (heel competitieve) familie "tot schande maakte".

Een interessant stukje hierover vind je op YouTube natuurlijk.

Daarnaast kijk ik op YouTube naar mijn favoriete filmfragmenten, zoals deze wonderschone scène uit Blade Runner.

"I've seen things you people wouldn't believe.
Attack ships on fire off the shoulder of Orion.
I watched C-beams glitter in the dark near the Tannhauser gate.
All those moments will be lost in time, like tears in rain.
Time to die."


"It's too bad she won't live. But then again who does?"

Snif. Zalig.

Gelieve de boel niet af te breken als je de film nog nooit gezien hebt of zelfs niet kent. 't Is een heel diepgaande Sci-Fi parel.

Jaja, KLJ, je leert wat bij

2008-06-25 22:41:46
Posts: 231

A, en ook nog veel sterkte natuurlijk

Nu weer rap voortdoen. Wat doe ik hier nog?

2008-06-25 22:58:31
Posts: 169

zie ook hier mijn laatste bericht tijdens deze examen periode:

tijdens de examens doe ik: voorbereidingen trefen voor snode plannen na de examens, inkopen doen voor na de examens, ....

kortom bezig zijn met alles van na de examens

btw die kerel met zijn pinnen in de kopkes van zijn patienten werkte da eigenlijk ???

2008-06-26 02:00:40
Posts: 231

Concrete "success rates" vind ik niet meteen (waarschijnlijk omdat het niet eenduidig te definiëren valt wat "succes" was en wat niet), maar blijkbaar overleefde 14% de procedure zelfs niet...

Hier nog twee interessante artikels erover:

[quote=Elizabeth Day, The Observer]Spurred on by his first-hand experience of the horrors of state-run mental institutions and determined to make his name as a medical pioneer, Freeman developed a version of Moniz's procedure that reached the frontal lobe tissue through the tear ducts. His transorbital lobotomy involved taking a kitchen ice pick, later refined into a more proficient instrument called a leucotome, and hammering it through the thin layer of skull in the corner of each eye socket. The pick would then be scrambled from side to side in order to damage the frontal lobe. The process took about 10 minutes and could be performed anywhere, without the assistance of a surgeon.

Over the years, Freeman developed a reckless enthusiasm for the operation, driving several thousand miles across the country to carry out demonstrations at asylums and hospitals. An instinctive showman, he sometimes ice-picked both eye sockets simultaneously, one with each hand. He had a buccaneering disregard for the usual medical formalities - he chewed gum while he operated and displayed impatience with what he called 'all that germ crap', routinely failing to sterilise his hands or wear rubber gloves. Despite a 14 per cent fatality rate, Freeman performed 3,439 lobotomies in his lifetime.

For the survivors, the outcomes varied wildly: some were crippled for life, others lived in a persistent vegetative state. Rose, John F Kennedy's sister, was operated on by Dr Freeman in 1941 at the request of her father. Born with mild learning difficulties, she was left incapacitated by the procedure and spent the rest of her life in various institutions, dying in 2005 at the age of 86. Yet occasionally, the operation appeared to have a calming, desensitising effect on the mentally ill. The lobotomy's mixed success rate was a symptom of its imprecision: it was a hit-and-miss procedure developed at a time when little was known about the very specific nature of the brain's structure.[/quote]

2008-06-26 10:22:49
Posts: 231

Alleeeeen, ik ben zooo alleen...

Sterkte aan mezelf dan maar

2008-06-26 16:29:03
Posts: 329

Niets Van !!!!!!!

ma kben wel te leeg om al die teksten te lezen en filmkes te bekijken
( te lang jah)

Veel sterke toegewenst Putte

Aan tom ist waarschijnlijk al ni meer nodig, misschien sterkte om nog thuis te graken.


2008-06-26 17:21:36
Posts: 169

naar de klj gaan hockey spelen ideaal om nog meer gefrustreerd te graken

2008-07-17 10:32:57
Posts: 169

hmhm het is toch weer zover?
laten we dit toppic uitbreiden tot een "ga en verspreid uw TOFFE kennis" aan anderen

zo heb ik net geleerd over de stier Herman genetisch gemanipuleerd en zijn dochters hebben medicijn in hun melk !!
verder tijdens de examens doe ik een poging om het forum wat leven in te blazen en de vele kijkers van het forum tot posters te motiveren

2008-12-27 11:56:59
Posts: 329

Tijdens de examens doe ik...

ook een bijdrage aan het forum! Bij deze zitten we aan 1000 (duizend!) posts

Over die toffe kennis, dan denkek niet dak veel te zeggen eb da iemand anders interseert.

Vertel meer over Herman, de bronstige stier

2008-12-27 12:45:11
Posts: 169

meer over Herman geen probleem: hij staat nu opgezet ergens in een museum in holland, in 2004 hebben ze hem laten inslapen omdat hij artrose had.
voor de rest hm niet zo speciaal eigenlijk heel erg bronstig was ie niet want door datie transgeen was, was zijn zaad blijkbaar minder vruchtbaar dan ander zaad !!!

2008-12-27 13:37:32
Claas Van Assche
Posts: 238

aa good old forum. Tijdens de examens doe ik, niets anders dan anders om het kort te zegen.

Eje nog je server van cs merlier?

2008-12-27 14:30:41
Bart Van Hulle
Posts: 28

tijdens de examens doe ik....
alles waar ik goesting in heb, want examens what the fuck zijn examens, oh ja studenten die heel het jaar niets om handen hebben dan te gaan bakken en jups drinken moeten zich dan eens een paar weken inspannen en direct slaat de verveling toe. lange leve de tsolders die werken. niet te min veel succes aan allen die zich in het zweet werken voor een prof die toch het studenten leven niet snapt.

2008-12-29 22:23:22
Lode Coopman
Posts: 62

tijdens de examens doe ik...
Wachten tot god mij alle verstand van de wereld gaf,
enja tijdens dat wachten ben ik maar wat aan het studeren om mij bezig te houden

2008-12-30 08:47:23
Posts: 169

ik maak ook veel studeer plannen van hoeveel pagina's kan ik nog doen wil ik nog doen, het toffe hieraan is dat je om de drie uur ongeveer merkt dat niet haalbaar is en je een nieuw plan kan opstellen !!

2008-12-30 14:06:31
Posts: 169

studeren als ik dood ben tijdens cs

2008-12-31 01:01:52
Posts: 329

Ik maak al lang geen plannen meer wegens bovenstaande reden

2008-12-31 01:02:13
Posts: 231

Tijdens de examens zit ik op een onverstandig uur langverwachte (doch vaak even onverstandige) foto's online te zetten.

2008-12-31 01:44:45
Posts: 329

Onverstandig uur? Das ideale training voor oudejaars avond!

2008-12-31 11:11:29
Posts: 169

be sure of that!!, hm tof dat putte wacht tot den blok om die foto's online te zetten ... dan kunnen we nog es lachen, wat vind je trouwens van mijn adonis lichaam rrr. tijdens de examens kijk ik dus uit naar momenten dat we weer lekker marginaal kunnen doen

2008-12-31 11:15:55
Posts: 329

Binnen de 24u gaat ge wensen dat ge nooit zo marginaal geweest waard

2008-12-31 11:20:28
Lode Coopman
Posts: 62

Hmmm de laatste uren van 2008 komen eraan, wie doet de laatste post van het jaar? ....

2008-12-31 11:39:12
Posts: 329

Da zal dan wel weer Claas zijn zeker, die slaagt er in altijd als laatste te posten

2008-12-31 11:50:02
Bert Meirhaeghe
Posts: 141

ik doe een poging, natuurlijk nog veel te vroeg

2008-12-31 12:54:25
Posts: 329

Zo hier mijn zielige poging

2008-12-31 17:41:43
Posts: 169

alsook stoopmans werpt een gok klop zes uur iedereen MOEST al int lokaal zijn wee uw gebeente als je durft nu nog te posten, alhoewel dan verlies je uw deel schuimwijn hehe meer voor ons tot straks

2008-12-31 18:02:02
Bert Meirhaeghe
Posts: 141

ik heb mijn deel al binnen
maar zeker weten dat er nog één of andere zielepoot gewoon gaat wachten tot 19u of zo om nog iets te posten.


bij deze hoop ik die persoon wat afgeschrikt te hebben zodat ik toch de eer heb de laatsten te zijn van 2008

2008-12-31 18:05:02
Bert Meirhaeghe
Posts: 141

en direct ook de eerste post van het jaar


een funny filmpje om te starten

2009-01-01 13:36:31
Claas Van Assche
Posts: 238

ziehier ook een post, tsja, ge moet alijk iets latn weten e. Ik ging gisteren om 10 nog een postje plaatsen, maar als ik thuis kwam dan zaten er al 2 personen op mij te wachten bij mij thuis tewijl een deel van mijn familie raclette zat te eten. We moesten ook nog onzen trein halen dus ister niemer van gekomen. Bij deze alijk een gelukkig nieuwjaar e

2009-01-01 16:51:18
Posts: 169

oké jongens klaar voor een didactische noot? here we go

ik leer momenteel over hoe het water van in de wortels van bomen tot helemaal bovenaan graakt dus tegen de zwaartekracht in. bijvoorbeeld de sequoia is ongeveer 120 meter hoog ...!!!

het is allemaal ons aller zon die hiervoor zorgt door dat zij schijnt op de bladeren bovenaan verdampt het water daar en aangezien er heel sterke cohesie krachten zijn tussen de watermoleculen onderling gaan deze steeds een aaneengesloten ketting vormen dus er kan geen luchtbel ontstaan waar ook in de waterkolom (xyleemvat)
als er tussen bovenaan water verdampt moet er onderaan vers water bij worden aangezogen
deze stroom is essentieel voor alle planten op aarde om voedingsstoffen te verspreiden in de plant

bij deze veel blokgenot

2009-01-03 17:07:20
Claas Van Assche
Posts: 238

ik zou graag ook zo eens een o zo interessante anekdote vertellen over mijn leerstof maar helaars . Het interessantste van mijn leerstof is, eeum, ffkes denken


still nothing

et eenige dat aan stoopie zijn ding kan tippen is eigenlijk praktisch etzelfde. De natuurlijke watercirculatie in een cv-lijdingnet. sjiek e

2009-01-03 22:40:22
Posts: 231

"helAARS", Claas? Welk vak is dat precies?

2009-01-03 23:24:00
Bert Meirhaeghe
Posts: 141

Zoek de spellingsfouten in Claas zijn laatste post.
Jawadde dadde.

2009-01-04 02:38:30
Claas Van Assche
Posts: 238

jah, kweet, ik ben blij dat ik geen Nederlands meer heb. Dat hoort tot het vak verwarmingstechnieken. Hier ziet men hoe het warmere water stijgt, afgekoeld word door de radiatoren en dan terug nederdaald naar de boiler. Dit omdat warm water lichter is dan koud water, dus warm stijgt, koud daalt. Interessant e

Momenteel ben ik bezig met het examen koeltechniek dat ik dinsdag heb. Het zijn 2 klaseurs en nog een klein mapje bij. Zoals ge allemaal ziet ben ik goed aan het leren . Maarja, het is een vak dat ik goed kan dus geen probleem .

2009-01-04 10:52:09
Posts: 329

Zeg Claas ge kunt ook papier gebruiken in plaats van classeurs om op te schrijven.

2009-01-04 14:32:17
Lode Coopman
Posts: 62

Jaaa classeurs om op te schrijven, das weer ieten voor de bedenkers. Handig, je kan het niet (toch moeilijk) verliezen. Brand beter na de examens,...

2009-01-04 18:00:55
Claas Van Assche
Posts: 238

kdenk dat papier toch beter brand ze , ofwel eens de test? :d kheb hier toch nog wat cursussen liggen, ze delen dat ieder jaar uit opt school, kverstaat ook ni ze waarom . Ieder jaar opnieuw delen ze van die papier bundels uit, kheb et ze nochtans al gezegd dat we op aardgas stoken bij ons thuis. Niet willen luisteren e

2009-01-04 18:39:04
Claas Van Assche
Posts: 238

tijdens de examen wacht ik tot mensen antwoorden op mijn posts.


2009-01-05 10:15:55
Dries Delbecque
Posts: 2

Ik wens alle studenten veel succes toe tijdens de examens. Nu heel even op de tanden bijten en dit in juni nog eens herhalen en de zomer zal nog nooit zo mooi geweest zijn. Als je het eventjes niet meer weet denk dan maar eens aan wat je deze zomer allemaal zou missen. Veel Succes....

2009-01-05 14:19:29
Claas Van Assche
Posts: 238
Posts: 169

ik koop een nieuw toetsenbord in de examens, en leer over de witzietke

2009-01-05 19:30:37
Koen De Smet
Posts: 16

man man man, zalig met wat een mens zich tijdens de examens kan bezighouden... Indertijd bestond er nog geen klj forum om je interessante weetjes (blijken wel zeldzaam te zijn) te posten.
Waar ik mij tijdens de examens mee bezig hield, was alles volgen op tv (yep, zelfs familie) en vanzelfsprekend op de commando's spelen op de pc

Ik vraag me toch af wie tot nu toe de meest nutteloze post heeft getypt, naar mijn mening heeft Stoopke zonet wel een goede optie genomen. Toch ben ik blij te weten dat je een nieuw toetsenbord hebt gekocht Is het een ergonomisch toetsenbord?

2009-01-05 22:12:43
Posts: 169

mijn toetsenbord is zeer stijlvol komt van de carrefour en typt vlot. Ik kan natuurlijk wel veel nutteloze berichten sturen maar ik doe tenminste een poging om iedereen wat bij de leren ... en als pauze is er bij ons nog steeds counterstrike é, wij gaan tenminste niet op café tijdens de blok/ examens

2009-01-06 00:01:25
Posts: 231

Al bijna 3 dagen geen posts in dit topic! Wat is de conclusie? Tijdens de examens doet men NIETS?

Ondertussen weet ik wel al dat ik verslaafd begin te worden aan Friends For Sale op facebook :$
Shame on me. Gelukkig pakt da nie veel tijd.

2009-01-08 21:12:49
Bert Waelkens
Posts: 43

oke, ik doe een poging:

Ik heb geleerd hoe ge via de computer genen van de mens kunt opsporen. zo weet ge tenminste wat er in u cellen zit en gebeurt.

Iedereen praat over dna, maar wat is dna nu eigenlijk? welja dna zit in de celkern en is een zeer lange molecule die bestaat uit slechts 4 kleine molecules A,C, G en T waarvan de volgorde van de 4 molecules in de zeer lange dna molecule de informatie bevat om eiwitten aan te maken. bvb we hebben een dna molecule ACGTAAGCTAATTCGCGTACC deze zal dan door onze cel vertaalt worden in een eiwit bvb hemoglobine (dat in ons bloed zit). deze dna molecule (ACGTAAGCTAATTCGCGTACC) noemt men dus het gen voor hemoglobine. de zeer lange dna molecule van de mens (3*10^9 a,c,g of t) bevat dus zeer veel van die stukken dna of genen, ongeveer 25000. de lang dna molecule van de mens is in 23 stukken verdeeld, namelijk 23 chromosomen, dus chromosomen zijn grote stukken dna die samen het genoom van een mens vormen. duidelijk?

Nu is het mogelijk dankzij de bioinformatica reeds gekende genen op te zoeken via genome browsers bvb via dencbi genome browser zie je alle 23 chromosomen van de mens. als je nu bvb op het X chromosoom klikt, zie je welke genen reeds op het X chromosoom bekent zijn, en op deze genen kan je dus verder doorklikken en de sequentie terug vinden. sequentie = de volgorde van de moleculen a c g en t.

grt Bert

2009-01-09 10:27:53
Posts: 329

Das pas interessant!

Kleine bedenking Bert: ik dacht dat de mens 46 chromosomen had? Ja ok de meeste zijn wel dubbelaars, maar just is just

En dan had ik graag nu een minuut stilte gehouden voor Stoopmans en Claas die nu aant afzien zijn op under examen

2009-01-09 11:07:20
Claas Van Assche
Posts: 238

thx merlier! de tussenstand is nu 1-2 bij mij. We doen ons best.

2009-01-09 11:21:40
Bert Waelkens
Posts: 43

ja, das waar, maar dat was om het simpel te houden.

voor de liefhebbers: een mens is een diploïd organisme, en heeft dus 2 kopijen van zijn genoom, dus 23 x 2 = 46 chromosomen. organismen zoals bvb algen,wieren zijn haploid en hebben maar 1 kopij van hun genoom.
de meeste chromosomen, 22 bij de mens zijn autosomale chromosomen, waarvan je dus telkens een dubbel hebt zitten. 44 in totaal dus. Telkens een dat je hebt van je vader en een dat je hebt van je moeder, dus de twee kopijen van ieder chromosoom kunnen dus wel van elkaar verschillen.(dit brengt ons dan bij dominantie en recessiviteit). we hebben ook een paar geslachtschromosomen X en Y, die zullen bepalen of je tot het superieure geslacht behoort of niet. als je XX hebt ben je een vrouw en heb je dus een X chromosoom van je moeder geerfd en ook een van je vader, die XY is. wanneer je XY hebt, ben je een man en heb je een X chromosoom van je moeder geerfd, die enkel maar een X chromosoom kan doorgeven, en een Y chromosoom van je vader, die dus X of Y kan doorgeven. dus het is de vader die het geslacht bepaalt, met een kans 1/2, ofwel heeft gij een X door ofwel heeft hij een Y door ( eerste wet van mendel, onafhankelijke segregatie van genen). vandaar dus dat er evenveel mannen als vrouwen zijn in de wereld.

2009-01-09 11:28:46
Posts: 169

sorry gasten ik heb ^pas maandag examen en toch voel ik me gesteund door merlier thx !! hehe

2009-01-09 12:01:29
Posts: 111

bert zo een uitleg voor iets dat veel gemakelijker kan

zeg gewoon dat de man altijd bepaald wat hij wilt. wil hij weer een slaafje maken dan geeft het gewoon een X door. wilt de vader een adonis van een vent geeft hij een Y door.

2009-01-09 12:55:57
Hanne De Fraeye
Posts: 34

over de voortplanting van de mens gesproken jongens
wisten jullie dat:
het ejaculaat meestal in 4 tot 6 pulsen uitgestoten wordt (moet je eens tellen !) en bestaat uit 4 fracties:
1. pre-ejaculaat: eiwitachtige visceuze afscheiding
2. eerste fractie: aangemaakt door de prostaat
3. hoofdfractie: aangemaakt door de prostaat, zaadblaasjes en de vas deferens
4. terminale fractie: gelatineuze secretie van de zaadblaasjes
Het grootste aantal zaadcellen wordt teruggevonden in de eerste fractie en in de hoofdfractie, terwijl de terminale fractie vooral onbeweeglijke zaadcellen bevat!

2009-01-09 16:42:05
Hanne De Fraeye
Posts: 34

ah en ook nog een tip voor de jongens om jullie vruchtbaarheid te verzekeren:
haal die laptop van jullie schoot!

2009-01-09 16:43:46
Hanne De Fraeye
Posts: 34

En nog een extra spelletje voor tijdens de examens:
zoek de vette dt fout in post 75 van de heer Bert Waelkens!

2009-01-09 16:45:22
Hanne De Fraeye
Posts: 34

Voila mijn aantal posts zijn verhoogd en zo antwoord er hier ook eens iemand van het vrouwelijke geslacht

2009-01-09 16:47:28
Bert Waelkens
Posts: 43

oke, maarja tmoest rap gaan e

...bvb we hebben
een dna molecule ACGTAAGCTAATTCGCGTACC deze zal dan door onze cel vertaald worden in een eiwit bvb

hopelijk is dit de enige dt fout, geef wel toe, nederlands is nooit mijn sterkste geweest.

2009-01-09 17:24:53
Hanne De Fraeye
Posts: 34

nee ik had het eigenlijk nog op een andere fout blijven zoeken ...

2009-01-09 17:33:14
Posts: 329

...reeds op het X chromosoom bekent zijn....

Wat heb ik gewonnen? (of is er nog een fout )

2009-01-09 17:53:39
Posts: 329

Vervolg op het spelletje: vind de fout(en) in Hanne's posts

2009-01-09 17:57:02
Claas Van Assche
Posts: 238

tzou grof zijn zeker als ik de fout eruit haal, gezien in nooit let op schrijffouten. Ik denk wel dak ze gevonden heb.

2009-01-09 18:55:53
Posts: 169

post 88 van merlier vind hehe zo straks zijn we allemaal nederlandse taalkundigen
systeem analyse is tof

2009-01-09 19:17:52
Posts: 329

Eyla Stoop, ni voor u beurt spelen, valsspeler! Ik had die daar natuurlijk express gezet

Kben blij da gij al de volgende opgave opgegeven hebt: vul de interpunctie in

2009-01-09 19:59:32
Koen De Smet
Posts: 16

deze is wel grappig van Bert:
"...ofwel heeft gij een X door ofwel heeft hij een Y door..."
kan natuurlijk verder aangevuld worden:
...ofwel geeft gij een Z door ofwel geeft hij een Q door...

2009-01-10 07:34:37
Koen De Smet
Posts: 16

ruwe gok, in het ganse forum 600 fouten.
(Aantal posts - posts Claas)*2/3
= (1075 - 175) * 2 / 3

misschien moet de formumle nog iets verfijnd worden...

2009-01-10 07:40:48
Posts: 231

De formumle, Koen? Wat is dat nu weer? Mijn kennis van het Nederlands gaat er blijkbaar zienderogen op achteruit...

Ik zal er maar van uitgaan dat je hier niet uit de toon wil vallen

2009-01-10 15:43:19
Posts: 169

tijdens de examens doen iK??? mij afvragen waarom de proffen hun examens zooo moeilijk maken. positief punt rond mij begonnen de vrouwen spontaan traantjes te laten zo ver is het bij mij toch nog niet ...
wordt vervolgd

2009-01-12 14:57:34
Hanne De Fraeye
Posts: 34

ej betrapt jij ging toch in je bed kruipen ?

2009-01-12 16:34:47
Lode Coopman
Posts: 62

Tijdens de examens doe ik : AFTELLEN : nog 16 dagen en tis gedaan!

2009-01-14 17:11:36
Lode Coopman
Posts: 62

Woehoe nog slechts 14 dagen!!!

2009-01-16 07:49:10
Posts: 169

doe ik : samen met lode aftellen ...

en denken hoe we een cocktail bar kunnen maken ...
en wat gingen we nog niet allemaal doen in de lesvrije week ...
hehe nog 12 dagen

2009-01-18 17:22:17
Lode Coopman
Posts: 62

jaja die coctailbar fabriceren maar ook een mega WC constructie bedenken, voor op den halve liter fuif!

2009-01-18 19:01:01
Lode Coopman
Posts: 62

hmm ik zal mijn fout maar zelf aanpassen:coctailbar ==> COCKTAILBAR

2009-01-18 19:04:17
Hanne De Fraeye
Posts: 34

ik vind dat er lichtjes rond de cocktailbar moeten, lode voor jou moet dat toch geen probleem zijn é?!

2009-01-18 19:19:08
Posts: 169

wow lode zo te zien wordt er veel van ons verwacht in die week we zullen veel moeten werken ...
als er nog ideeën zijn voor de cocktailbar moet je het maar laten weten é hehe

ps.: moeten er ook lichtjes aan die wc hangen

2009-01-18 20:37:33
Claas Van Assche
Posts: 238

zolang alst goeje cocktail is zal da allemaal wel goed komen . Mss ook et jonger volk achter dezen baar zetn, trekt ook altijd wat meer volk

2009-01-19 10:58:47
Claas Van Assche
Posts: 238

back on topic, tijdens de examens kijk ik toe hoe putte mij stront laat scheppen en wc's laat ontstoppen. Prettige bezigheid.

2009-01-19 14:50:04
Lode Coopman
Posts: 62

Ja wadde dadde, idd tom ze gaan hoge verwachtingen hebben zenne, die lichtjes kunnen geregeld worden!!!! Maar alle hulp is natuurlijk ook welkom van studenten die eens wat anders willen dan achter den bureau te zitten.

Hmm claas naar ervaring toe zouden we beter geen te jonge leden achter den cocktailbar zetten, remember vorig jaar en het jaar ervoor

Ik heb al een systeemke bedacht voor den wc, Snel en gemakkelijk!

2009-01-19 19:09:06
Posts: 329

Ik vraag mij af wa voor verschil dat da maakt wie dat er nu achter de toog staat?
Iedereen kan toch een bekerke vullen?

Wat is er misschien misgelopen de vorige jaren?

En voor die wc's: die halve buizen werkten toch goed vorig jaar

Enja in de lesvrije week willek gerust komen helpen...

2009-01-19 20:33:59
Posts: 169

laten we hier geen persoonlijke beschuldigen aan de dag leggen ....

nen burgie kunnen we altijd gebruiken bij de constructie é hoho dat wordt wat. Zeg moet daar een plan van getekend worden???lol

een pilsje derbij dast beste plan denk ik wel
pakt twee

2009-01-19 23:55:39
Lode Coopman
Posts: 62

Persoonlijk beschuldigingen?
enja we kunnen dan ook gewoon die halve buizen van vorig jaar houden als wc

2009-01-20 07:55:49
Lode Coopman
Posts: 62

Met naar ervaring toe bedoelde ik ook namenlijk mezelf: ik heb op mijn eersten fuif van klj waregem (waarvan ik beter de naam niet uitspreek)heb ik ook achter den cocktailbar gezeten, (jeneverbar dan), met alle gevolgen vandien ... Dus zeker geen beschuldiging aan de jonge leden !

allé ja bij deze

2009-01-20 08:03:08
Posts: 169

die buizen waren idd oké maar moeten we geen systeem vinden om de pis af te voeren tot achter de hekkens dan stroomt dat daar niet :d

2009-01-20 12:12:03
Posts: 111

dit is msch een constructie voor de coctailbar


2009-01-20 16:34:21
Posts: 169

ahzo als de ambities zo hoog liggen, enfin ik had eer iets met tien paletten in mijn hoofd :d
hehe we zien wel hoe hoog we de lat leggen

2009-01-20 19:51:31
Claas Van Assche
Posts: 238

tis altijd wel goe als ge der uw werk van maakt. Ik heb denk ik geen lesvrije week. Bij ons ist direct stage en eindwerk (1 week voor te beginnen) en daarna SBP. Nuja, tijdens sbp gaak normaal tijd over ebben. Dan kan ik altijd helpen!

2009-01-20 22:50:58
Posts: 329

Ge zit nu in u lesvrije week claas!!
Waarvoor sta SBP eig?

Is het eigenlijk de bedoeling om van scratch te beginnen, of de oude coctailbar up te graden?

2009-01-21 09:34:52
Posts: 111

ik ben ook thuis nu

ik kan msch al eens een tekeningetje maken
je weet nooit dat het een superieur idee kan zijn e

2009-01-21 09:54:43
Posts: 111

voila een eerste schets


2009-01-21 10:36:20
Posts: 111



2009-01-21 10:46:29
Posts: 329

Eigenlijk ist cocktailbar

2009-01-21 10:48:01
Posts: 111

derde keer goede keer zeker


2009-01-21 10:50:30
Posts: 169

waarom dat gat? tis niet de bedoeling dat het volk in en uit kan lopen é :d hehe

maar anders niet mis

2009-01-21 10:55:58
Posts: 329

Welk gat bedoelde gy?

tekening links is gewoon et vooraanzicht en rechts het zijaanzicht e stoop?

correct me if i'm wrong

2009-01-21 11:03:59
Claas Van Assche
Posts: 238

ja volgens mij eje gelijk wi merlier. Trekt wel een beetje op die foto da mini al nekeer gepost eeft. Maar theeft wel iets, zet er nog da bambou dings rond en wa flessen in de lucht da ge gebruikt hebt in de cocktail en das dik inorde e, mss iets van een daksken maken daarvoor.

sbp staat voor small Business project. Onzen opdracht is (6 man) van een vrachtschip een hotelboot maken met iets van 10 kamers erin en een cafetaria derboven met terras. Nuja, wij met ons 6 man moeten alles van sanitair voorzien, samen met de verwarming en zo. Dit alles zo ecologisch en economisch mogelijk. Dus hernieuwbare energie zoveel mogelijk gebruiken. Et toppunt is daarvan, vin ik toch, we ontwerpen het met 2 verschillende teams van elk 6 man. Et beste team wint en zo zal den boot dan ook komen. Maar tzijn dan maar 2 man die de effectieve uitvoering mogen doen van den boot. 2 man, een volledig schip voorzien van sanitair en heel den bataklan. Et moet dan nog kunnen varen, et moet stabiel liggen, et roer moet nog altijd int water blijven liggen, ...

redelijk spel da

2009-01-21 13:47:19
Posts: 329

Als ek da zo hoor is winnen ni zo interessant

2009-01-21 14:26:08
Posts: 169

ik schaam me diep over mijn opmerking hehe examens kunnen een heldere geest vertroebelen

2009-01-21 16:48:49
Posts: 329

Wa zal dat dan niet geven achter de examens!

2009-01-21 17:36:04
Posts: 169

ik denk dat er dan eerder geen geest meer zal zijn

2009-01-22 02:05:16
Posts: 111

ik keb maar 1 oplossing

en date is na de examens een goe ( of 2,3,4,5,6,7,8,9,........) glas bier gaan drinken :d

2009-01-22 09:00:55
Claas Van Assche
Posts: 238

eeum mini? bier als oplossing voor bier?

Merlier zei of bedoelde toch geloof ik, de geest gaan vertroebelen met bier

Stoopke dan, der zal geen geest meer zijn (door overvloedig bierconsumptie denk ik dan)

en gij zou da dan oplossen door nog meer bier te verorberen? Goe plan

2009-01-22 11:51:19
Posts: 111

ja ze zeggen toch altijd

je moet eindigen waarmee je bogonnen bent

enfin nen goeien tauro kan geene kwaad

2009-01-22 12:00:18
Posts: 111

en voor diegene dat da nie graag drinken

hup hup hup en goe pilske in ene wup. of zoiets

2009-01-22 12:03:31
Posts: 169

zozo nog 4 keer slapen en tis van dade ... zijn er van jullie die zin hebben om donderdag avond iets te gaan boozen in de fools?/ vrijdag plakaten gaan zetten ge ziet wel

2009-01-25 14:10:01
Posts: 169

dat van de fools slaat op donderdag avond ...

2009-01-25 14:11:17
Posts: 111

we kunnen msch donderdag een ontwerp van de cocktailbar bespreken

2009-01-25 16:06:22
Posts: 169

der zal wel inspiratie zijn (b)

2009-01-25 17:11:27
Posts: 169

putte zijn smiley's kennen (b) niet spijtig

2009-01-25 17:12:05
Posts: 329

Ja putte mag dan es een lijstje maken met alle smileys dat we kunnen maken

:-| :@ kent iedereen wel zeker? Maar wie weet zijn der nog meer!

2009-01-25 17:23:35
Posts: 329

Iedereen behalve et forum dan blijkaar ^o)

2009-01-25 17:24:11
Bert Waelkens
Posts: 43

Donderdag heb ik ook gedaan, dus zou het wel eens kunnen dat Bert Waelkens zijn fietske pakt en richting fools rijdt die bewuste avond, om er te werken aan een plan voor de cocktailbar. die fiets is voor de frisse lucht wel te verstaan.

2009-01-25 18:30:17
Posts: 169

oké ik ga eerlijk zijn, ik had ook al gedacht om met de fiets te gaan .... maar da niet voor de frisse lucht maar gewoon voor te kijken of mijn fiets nog in orde staat é kzal in elk geval de banden eerst moeten pompen :d

2009-01-25 18:49:07
Posts: 111

ik zal ook wel aanwezig zijn
denk zelf ook om met de fiets te gaan
want treinen rijden zo lang niet é

2009-01-25 19:47:07
Lode Coopman
Posts: 62

Mijn fietsken staat ook al paraat
(nog 3 nachten slapen )

2009-01-26 17:34:00
Koen De Smet
Posts: 16

aha, de jeugd gaat het geld opnieuw laten rollen.
het einde van de economische crisis is nabij!

2009-01-26 22:49:53
Posts: 169

geld rollen niets van hier met die cara !!!! hm nog twee keer slapen

2009-01-27 11:05:03
Posts: 169

hmhm tijdens de examens doe ik ....
merken dat de vijver achter mijn kot nog steeds bevroren is ... zot toch maar ik zou er nu toch niet meer oplopen ...

2009-01-27 15:25:14
Lode Coopman
Posts: 62

hmmm nog 46h en 50min

2009-01-27 17:45:30
Posts: 111

nog 1 keer slapen

2009-01-28 12:54:58
Posts: 329

Om de laatste dagen toch draaglijker te maken: hier een superspel 'chronotron' genaamd

Tis vree simpel: ge moet de levels tot een goed einde brengen door een chip te vinden en dan terug te keren naar het begin. Om u te helpen kan je meerdere instanties creëren van uzelf, met behulp van een tijdsmachine. Dit _uiteraard_ zonder een paradox te maken

Have fun!

2009-01-28 15:54:50
Posts: 169

filo is fijn vooral als je er maar 1 dag tijd voor hebt ....

2009-01-28 22:26:18
Posts: 169

slapen zou fijn zijn, mssh ben ik morgen niet zoooo fris maar da fixen we wel

2009-01-29 04:32:58
Posts: 169

slaapwel examen forum je was weer super ....
tot vnvd vriendjes

2009-01-29 11:40:59
Posts: 329

Tijdens de examens....
sta ik veel te laat op, maar den eersten dag van de vakantie bennek wel wakker om 9u

2009-01-30 10:53:48
Posts: 231

[quote=Merlier]Ja putte mag dan es een lijstje maken met alle smileys dat we kunnen maken
:-| :@ kent iedereen wel zeker? Maar wie weet zijn der nog meer!

Zo, er zijn er nog 2 ontbrekende bijgemaakt, en onderaan worden ook de ondersteunde smileys opgelijst wanneer je een berichtje wil toevoegen.

2009-03-01 13:40:40
Posts: 329

Boos en bloos zijn precies hetzelfde?

2009-03-01 15:58:12
Posts: 231

Yep, en lekker puh was ook fout. 't Moest rap gaan

Exotischere dingen gelijk een pint (b) zou ik liever niet meteen ondersteunen, omdat er meerdere icon sets zijn (al zie je die momenteel nog niet omdat ik dat nog moet programmeren) en die hebben daar niet allemaal een icoontje voor.

2009-03-01 19:08:35
Bert Waelkens
Posts: 43

ja mannen,tga were beginnen e.
lange dagen leren afgewisseld met pauzes waarin je forums afschuimt en ziet hoe iedere student zijn mentale toestand erop achteruitgaat naarmate we verder in de examenperiode zitten.
en kon het gewoon niet zien dat het "wat ik doe tijdens de niet - examenperiode" topic bovenaan stond.

Succes aan iedereen en aan mezelf.

2009-05-13 21:19:36
Posts: 329

Voor mij ist ook officieel begonnen... vanaf nu MOET dus dit topic ten aller tijde boven het "wat ik doe tijdens de niet - examenperiode" staan.

Ook van mij veel succes gewenst aan alle dutsen

En voelt ge de plotse drang om de grootste zever hier te zetten, niet twijfelen

2009-05-20 10:34:45
Lode Coopman
Posts: 62

Yap, de examenperiode is van start gegaan ...

Maar om optimistisch te blijven : nog 34 dagen en tis vakantie!!!!!

Veel blokplezier aan alle studenten alvast!

2009-05-20 11:20:09
Posts: 329

Wat denkt mini wel niet zeg

Topen dage u verbrand in de zon :@

2009-05-21 16:25:55
Posts: 169

aha ook stoopmans is er officieel aan begonnen lekerrrr lerrren njummie njummie
ook van mijnentwege iedereen veel succes aan iedereen die dus niet moet studeren geen succes ah behalve diegene die een kindje verwachten!!!
btw zorgt dat het kindje niet geboren wordt in de maand juni das echt te klotig om in de examens te verjaren.

2009-05-21 20:18:14
Claas Van Assche
Posts: 238

kwist niet zeker of ik het hier in dit topic moest plaatsten of in de niet examen periode, maar goed tis dit geworden.
Veel succes en al aan ieder dat examen heeft en alst moeilijk gaat moeje maar zegn, tis voort diplom .

2009-05-23 20:29:07
Céline Dewitte
Posts: 19

Kijken wat ik volgend jaar als praktische proeven van m'n eindwerk ga doen
Ik zou graag iets biologisch doen
M'n leerkracht had me al opgegeven om iets met de aardappel te doen maar ik kan niet zo goe die labo's uitvinden. Tmoet serieus genoeg zijn, maar ook haalbaar en das tmoeilijkste... In m'n schole sta der zo veel apparatuur nie wije. Mag zowel op de plant als op de petat zelf zijn. We mogen ook naar bedrijven gaan om iets uit te voeren, das beter ma ook lastiger om te vinden. Nu is m'n vraag of jullie nog goeje prakticums zouden voor me weten. Heb je nog andere onderwerpen met proeven die goe zijn vo iem int 5de TW. Roept ma

2009-05-30 17:38:38
Hanne De Fraeye
Posts: 34

hey céline ik ken niet zoveel van patatjes

maar wat zeker ook past in dit 'tijdens de examens doe ik ...' topic is: plannekes maken voor de vakantie --> ik zou graag nog keer naar diedjies gaan en de eerste zondag na de examens dat mij maar past is op 19 juli. Wie gaat er mee?

nog veel blokgenot!

2009-05-30 19:40:47
Posts: 169

@ céline: als bio - ir voel ik me moreel verplicht je wat tips te geven :

1) een vriendin van mij heeft een vergelijkende studie gemaakt over aardappelteelt in vlaanderen en Bogotta(Peru) deze zou je kunnen kopieren en in verstaanbare taal schrijven heel tof en vandaag de dag zijn vergelijkende studies heel "in" natuurlijk kan je hierbij practisch niet zoveel doen buiten info lezen ....

2) rassenproeven: rassen telen onder dezelfde omstandigheden en kijken welke best opbrengt
toffere variant: droogte stress geven aan je patatten en kijken welk ras het beste droogteresistent is ... en dus beste opbrengst heeft in droge seizoenen

3) bemestingsproeven: verschillende bemestingsniveau's vergelijken .... qua opbrengst

4) Doden van groengroei: bij patat worden de bladeren dikwijls tegen het einde van de groei verwijderd. Dit om meer energie naar de knollen te laten gaan. hier kan je ook verschillende maai niveau's vergelijken, dit wordt ook gedaan via "doodsproeien" van de planten ook hiermee kan je dan vergelijken! BOEIEND

Onder de categorie: Iets moeilijker realiseerbaar.

5)verschillende lichtbehandelingen geven aan planten! aardappels telen onder serre's wordt misschien in de toekomst steeds belangrijker (vervroegen van de vroege patattten) hiervoor kunnen verschillende lichtbehandelingen aangewezen zijn bijvoorbeeld constant wit licht geven/ rood licht/ donder rood licht ... heel veel varianten zijn mogelijk.

6) Verschillende CO2 behandelingen geven ook vooral voor serre teelt is een heel "hot topic" in de landbouw.

Zo ik hoop dat je hier iets mee bent verdere uitleg van al deze zaken kan je bij mij persoonlijk verkrijgen ik weet overal wel wat theorie bij ... De wetenschapper B.W. ongetwijfeld ook !!
misschien zijn al die proeven niet haalbaar genoeg maar dan komt dat omdat de KUL mij zo geboetseerd heeft !

Ah nog iets mssh niet onbelangrijk in Kruishoutem zit er een groot proefcentrum voor de aardappelteelt deze staan heel open voor studenten (ook die vriendin van mij is daar langs geweest!).
allé veel succes ermee

@ Hanne: IK GA MEE !! olé olé

2009-05-30 20:16:34
Posts: 169

ah tijdens de examens help ik andere studenten om zo mijn eigen miserie te verdringen denk ik ....

2009-05-30 20:17:49
Céline Dewitte
Posts: 19

@ Hanne:

Ik ga ook mee wije!!!
Akke mag en kan ten minste, ma tis achter de examens zedus...
Da hoort bij den blok é, an de vakanse denken
Deda xx

@ Tom:

Jawadde!! Zok nen uitleg! tzitten wel enorm veel goeje dingen in
Bedankt voor de reactie, zal ze eens voorleggen an m'n titularis
Vooral de droogtetest, bemesting en belichting lijkt me nog twa geestig om te doen
Da proevencentrum lijkt mij vree goe! Kwist da zelf nie da der daar ene zat en da zou super zijn moesten ze mij daar binnenlaten voor informatie enzo
Khoop daje nie te veel miserie hebt met ui examens
Merci vo de hulp en nog veel leergenot, zou ik zeggen

@ Hanne én Tom en eigenlijk iedereen die ant blokken is

Veel succes met de examens!!!!
Doe da goe, we hebben ton een hele vakanse vo leute te maken

2009-05-31 13:35:29
Posts: 169

creazy taxi spelen op facebook en zien dat bert W het totaal niet aankan om mij te verslaan :d :d:d
natuurlijk blijven proberen !!!

2009-06-02 10:42:53
Céline Dewitte
Posts: 19

Paniekeren da ke nog veel te vele moe doen!


2009-06-04 17:24:21
Posts: 329

Volgende stap: aanvaarden en filteren van de leerstof, dan ist plotseling wel nog doenbaar

2009-06-04 19:19:54
Hanne De Fraeye
Posts: 34

Of een nachtje doorblokken

2009-06-04 20:44:46
Posts: 329

Nooit! Slaap is kweenie oe belangrijk

Nuja succes gewenst als ge et toch wilt proberen

2009-06-04 21:20:33
Lode Coopman
Posts: 62

Tijdens de examens doe ik: aftellen natuurlijk ==> nog 18 dagen (met vandaag derbij)

2009-06-05 16:25:57
Posts: 169

zien dat het nog twaalf uur is tegen mijn eerste examen .... tik tik tik

2009-06-08 02:12:44
Posts: 329

Succes dan maar zeker :-|

2009-06-08 14:18:44
Posts: 111
Hanne De Fraeye
Posts: 34

Tijdens de examens ... lees ik de krant (Weekend bijlage Het Nieuwsblad)

En ik ben beetje geschokt:

"De grote pilstest --> 20 pintjes en 6 bierproevers"
Enkele resultaten ...

1. Vedett 8/10
2. Bavik 8/10
3. Primus 7,5/10
6. Verhaeghe Pils 7/10
11. Bockor 5,5
13. Cara 5,5
14. Jupiler 5,5
16. Stella 5,5
17. Romy 5

Waar gaat dat toch naar toe met de wereld?
Ik vond dat ik dit jullie toch moest laten weten

2009-06-08 17:35:38
Posts: 329

Tijdens de examens las ik datzelfde artikel op het internet : klik

En inderdaad er is iets serieus mis met die test. 'Cara = Jupiler' is er over, Primus staat ook veel te hoog. Hoewel met de koppijn achteraf is er precies geen rekening gehouden in de test
Vedett staat wel op zijn plaats...

Ik stel voor dat wel achter de examens dezelfde test doen

2009-06-08 19:46:05
Hanne De Fraeye
Posts: 34

Ja die gasten zijn blijkbaar nog niet naar een fuif geweest, zo een achter de examens, in de vakantie of wanneer je geen bob bent en niet voor school moet werken de volgende dag, en je beslist om der keer goed voor te gaan en tis dan primus! pft ik ben dan diepbedroefd en gefrustreerd omdat ik dán al weet dat ik de volgende dag zeer in mijn hoofd zal hebben ...
Dat die bierproevers dáár eens rekening mee houden!

2009-06-08 19:57:50
Posts: 329

Tword tijd dat we eens een lijst maken met de beste fuifbieren, en die lijst in de krant zetten.
Dan leert gans vlaanderen van onze wijsheid

Zij maar zeker da Primus de helft ni aalt

2009-06-08 21:04:50
Posts: 169

iets in mij doet me vermoeden dat Merlier en Hanne zuiplappen zijn .... enfin ik krijg stillekes aan ook wel goeste in nen frizzen jup

2009-06-09 11:09:32
Bert Waelkens
Posts: 43

Heb ook wel zin in een paar pilsjes. Hoewel forum en crazy taxi (check score Tom, dat wordt weer hard werken) nu wel meer een verslaving zijn. wat zou er eigenlijk het gezondste zijn. U opjagen in immens domme spellekes of gewoon af en toe een pils drinken als pauze. tijd dat gedaan is

2009-06-09 14:15:39
Hanne De Fraeye
Posts: 34

Ik ga nu nog een koffietje drinken, mijn senseomachine draait met de examens op volle toeren, ie zal em der niet aan verstaan vanaf volgende weke

2009-06-09 15:39:41
Posts: 169

mja ik bewijs in de examens dat je snachts ook nog kan strak staan met een golden powerke derbij
zie facebook .... toch met een dikke 10 000 verscherpt dat wordt trainen bert !!
en nu weer verder doen

2009-06-10 01:39:52
Posts: 329

Zo weten we ook weer hoe Tom zijn verjaardag viert

2009-06-10 09:22:42
Céline Dewitte
Posts: 19

Kijken opt forum oeda Tom en Bert mekaar uitdagen met begot Crazy taxi!
Kwestie van een bezigheid te hebben binst de examens zeker?

2009-06-14 10:21:48
Posts: 169

der wordt deze keer niet zoveel gepost opt forum door de studenten hmhm de oorzaak hiervan behoeft wat verder onderzoek....

van creazy taxi ben ik gelukkig voorgoed verlost bert kan toch niet beter ....

2009-06-14 15:22:46
Lode Coopman
Posts: 62

hmmm redens zouden kunnen zijn :
- facebook
- netlog
- geen examens door stage
- beter weer (soms dan toch), dus pauze buiten nemen ipv op pc
- door schok van de pilstest

2009-06-14 18:15:12
Posts: 169

dit kunnen idd redenen zijn van de verwaarlozing van ons aller forum hmhm, ik ben tijdens een van mijn pauze eens tot het lokaal gefietst en gemerkt dat we met 30 zijn om te gaan kajakken

2009-06-15 09:59:32
Lode Coopman
Posts: 62

tijdens de examens doe ik:
Blijven aftellen : nog 41uren en 12 minuten

2009-06-20 18:48:24
Posts: 169

hé marloes

ideaal als je het niet meer ziet zitten

2010-01-12 20:18:59
Posts: 169
Martijn Vanhaverbeke
Posts: 177

Die man is wel nie echt enthousiast ze...

anyways, ier nog een filmke:
Like a boss

2010-01-12 20:28:43
Lode Coopman
Posts: 62
Lode Coopman
Posts: 62
Claas Van Assche
Posts: 238

Nu we toch bezig zijn meer te posten opt forum en te belonen met een pintje wil ik ook een pintje weggeven.

Wie kan mij zeggen wat er niet klopt in het bovenstaande rijtje? We spelen voor een pintje e mensen ...

2010-01-14 19:50:34
Martijn Vanhaverbeke
Posts: 177

Kga toch ne keer proberen, want als we voor harde pils spelen...
het liedje van lode is niet van apres ski hut?

2010-01-14 21:11:13
Claas Van Assche
Posts: 238

Neen, jammer maar helaars.

2010-01-14 21:40:58
Martijn Vanhaverbeke
Posts: 177

Dan een maar een tweede poging... Het valt mij nu juust te binnen dat dit een topic is voor mensen die examens hebben, welke ik dus voor de moment niet heb

2010-01-14 21:47:06
Claas Van Assche
Posts: 238

Bingo! U dient hier idd niet te posten meneer, ik heb examen in december, kerel.

Maar het pintje is toch voor u

2010-01-15 13:51:25
Martijn Vanhaverbeke
Posts: 177

Ok, kheb het begrepen, dan nog 1 post om het af te leren

2010-01-15 16:31:42
Bert Waelkens
Posts: 43

From: [email protected]
To: [email protected]
Subject: RE: Betr.: posten op forum
Date: Sat, 16 Jan 2010 10:58:47 +0000


Ge hebt gelijk, ge krijgt een pils van mij de eerst volgende klj activiteit

grt Martijn

From: [email protected]
To: [email protected]
Subject: posten op forum
Date: Sat, 16 Jan 2010 08:58:47 +0000


Ge kunt het nu reeds posten van zever ook zien als voorbereiding op de komende drie, vier of vijf jaar. dan ga ge wel examens hebben in januari, juni en september. dus t kan geen kwaad om al eens te zien/oefenen hoe mensen met onherstelbare schade aan de hersenen door het studeren hun pauzes doorbrengen.

greetz bert

reply from martijn

2010-01-16 10:30:09
Martijn Vanhaverbeke
Posts: 177

Toch wel een goede poging Bert, alleen jammer dat:
1) U door de alcoolbeschadiging mijn achternaam verkeerd heeft geschreven
2) Mijn email adres iets geheel anders is dan hetgeen u neergezeverd heeft

2010-01-16 12:51:35
Posts: 231

3) Bert zijn mail-adres klopt wel en zodra een spamrobot hier nog eens passeert en dat mailadres oppikt, krijgt 'm lekker veel hoogst interessante mailtjes erbij (v1c0d1N, z0l0ft, enlarge your ...)

2010-01-17 14:03:38
Lies Vansteenkiste
Posts: 54

... ideetjes op voor de zomer


2011-01-17 17:40:41
Posts: 118

Ja, en we zijn officieel begonnen met de blok.
Iemand goeie tips voor een deftige pauze?

2013-05-19 14:34:01
Martijn Vanhaverbeke
Posts: 177

Tijdens de examens doe ik... oude threads opgraven!

2013-05-19 16:54:38
Lies Vansteenkiste
Posts: 54

filmke kijken "1941" van Steven Spielberg

2013-05-19 21:12:47
Posts: 118

nja een filmke, ma da duurt zo lang, en om da in stukjes te bekijken wordt mijn studie de reclame tussen een film en die spoel ik altijd door, dus da loopt nie goed af voor mijn studie

en ja Martijn, waarom niet he

2013-05-20 11:23:00
Posts: 118

ideetje voor een KLJ Activiteit?
(nu hoop ik Een heel toffe beschrijvingdeze link werkt)

2013-05-20 15:46:45
Martijn Vanhaverbeke
Posts: 177

Toffe contractjes op bierkaartjes schrijven!

2013-05-20 23:05:41
Posts: 118

ok, da was officieel een slecht plan. Kheb nu al 2 bierkaartjes waar ik officieel zwaar aan gekloot sta (en exuseer voor mijn taalgebruik )

2013-05-20 23:08:33
Posts: 118

tijdens de examens doe ik...
aftellen naar kamp en op het moment dat ik op Verstuur klik
is het nog 5782900 sec ofwel +-98381 minuten ofwel +- 1606 uur.
Klopt da of heb ik da nu verkeerd laten berekenen

2013-05-22 10:38:31
Posts: 118

teminste als je ervanuit gaat dat we om 9u vertrekken, wat ik afleid van een oudere ledenbrief

2013-05-22 10:42:16
Martijn Vanhaverbeke
Posts: 177

Nu ook met countdown in real time!

2013-05-22 13:11:32
Posts: 118

Boeja, nog maar 9956 keer naar het bloklied () luisteren en ik ben verlost van mijn examens
en nog 30518 keer het klj lied (), en dan ik het kamp

2013-05-22 14:49:07
Martijn Vanhaverbeke
Posts: 177

Tijdens de examens houd ik mij bezig met nutteloze posts te maken in het klj forum

2013-06-05 16:25:19
Posts: 118

ja Martijn, die post was inderdaad behoorlijk nutteloos,
maar eigenlijk is commentaar geven ook niet nuttig daaruit volgt dit is ook een nutteloze post,
Hmmm, die examens, nergens goed voor zeg ik u, ik zeg het u, nergens goed voor
ge begint ervan dingen 2 keer te zeggen

2013-06-07 16:05:26
Posts: 118

tijdens de herexamens doe ik...
vluchten van mijn boeken frans, terwijl ik da eigenlijk feitelijk niet mag doen hé...
(sorry voor de 100 procent nuteloze post ma de mensen die hem zien
moeten het maar ne keer zeggen, kheb zin om da te belonen met één drankje)

2013-09-05 10:29:53
Posts: 118

de vorige post is geldig tot 22 september

2013-09-05 10:36:27
Posts: 118

kleine toevoeging 22 september 2013 (voor de moeilijke mensen hé

2013-09-05 10:37:00
Posts: 129

Net gemerkt dat Martijn zijn countdown naar het kamp nu aan het optellen is.

2013-09-05 17:41:34
Martijn Vanhaverbeke
Posts: 177

Ik heb uw post gezien bernd Moet er ook nen countdown zijn voor het klj rad?

2013-09-05 20:28:51
Martijn Vanhaverbeke
Posts: 177

Trouwens, Jeroen: ik zie net dat u ook bijna aan 100 posts zit. Da wordt trakteren he

2013-09-05 20:29:55
Posts: 129

Haha, dat zal voor de forum ninja's zijn die het door hebben dat ik aan honderd zit. Wie weet wat er dan gebeurt...

2013-09-28 18:17:41
Claas Van Assche
Posts: 238

COuntdown in 3 ...

Jaja tis niet tijdens de examens dat ik hier zit, maar tijdens het wachten op de laserbron

2013-10-01 10:17:41